shRNA Lentivirus (self-inactivating), p7SK-(Gramd1a-shRNA-Seq1)(CAT#: LV-SI3914WQ)
This product is a Gramd1a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gramd1a gene is cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane (PM) to the endoplasmic reticulum (ER). The expression of Gramd1a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Gramd1a-shRNA-Seq1 |
| Related Target/Protein | Gramd1a |
| Region | CDS |
| TargetSeq | CGAAGATTATTTCCACCACCT |
| NCBI RefSeq | NM_027898 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |