shRNA Lentivirus (self-inactivating), p7SK-(JMJD8-shRNA-Seq2)(CAT#: LV-SI1156WQ)

This product is a JMJD8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The JMJD8 gene functions as a positive regulator of TNF-induced NF-kappa-B signaling and regulates angiogenesis and cellular metabolism through interaction with PKM. The expression of JMJD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert JMJD8-shRNA-Seq2
Related Target/Protein JMJD8
Region CDS
TargetSeq CAACACCTACTCCTACCACAA
NCBI RefSeq NM_001005920
Alternative Names PP14397; C16orf20
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancer
Target Gene
Gene ID 339123
Uniprot ID Q96S16

Related Products