shRNA Lentivirus (self-inactivating), p7SK-(KCTD2-shRNA-Seq1)(CAT#: LV-SI1418WQ)
This product is a KCTD2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | KCTD2-shRNA-Seq1 |
| Related Target/Protein | KCTD2 |
| Region | CDS |
| TargetSeq | CCTACTTTGGTCCTATCCTCA |
| NCBI RefSeq | NM_015353 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ischaemic Stroke and Alzheimer's Disease |