shRNA Lentivirus (self-inactivating), p7SK-(KHDRBS1-shRNA-Seq3)(CAT#: LV-SI1048WQ)
This product is a KHDRBS1-shRNA encoding Lentivirus, which is based on HIV-1 serotype.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | KHDRBS1-shRNA-Seq3 |
| Related Target/Protein | KHDRBS1 |
| Region | CDS |
| TargetSeq | GACGGCAGAAATTGAGAAGAT |
| NCBI RefSeq | NM_006559 |
| Alternative Names | p62; p68; Sam68 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Primary ovarian insufficiency |