shRNA Lentivirus (self-inactivating), p7SK-(Lamtor2-shRNA-Seq1)(CAT#: LV-SI4046WQ)
This product is a Lamtor2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Lamtor2 gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The expression of Lamtor2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Lamtor2-shRNA-Seq1 |
| Related Target/Protein | Lamtor2 |
| Region | CDS |
| TargetSeq | GCTGAATAATGAGGGATCGCT |
| NCBI RefSeq | NM_031248 |
| Alternative Names | p14; ENDAP; ROBLD3; HSPC003; MAPBPIP; MAPKSP1AP; Ragulator2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Primary immunodeficiency syndrome |