shRNA Lentivirus (self-inactivating), p7SK-(Lipk-shRNA-Seq1)(CAT#: LV-SI3928WQ)

This product is a Lipk-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Lipk gene plays a highly specific role in the last step of keratinocyte differentiation and may have an essential function in lipid metabolism of the most differentiated epidermal layers. The expression of Lipk-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lipk-shRNA-Seq1
Related Target/Protein Lipk
Region CDS
TargetSeq CCTTATCTACTACAAGGAGAT
NCBI RefSeq NM_172837
Alternative Names LIPL2; bA186O14.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 643414
Uniprot ID Q5VXJ0

Related Products