shRNA Lentivirus (self-inactivating), p7SK-(LOC286238-shRNA-Seq2)(CAT#: LV-SI1084WQ)
This product is a LOC286238-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LOC286238-shRNA-Seq2 |
| Related Target/Protein | LOC286238 |
| Region | CDS |
| TargetSeq | GAGACCTGGAAATGTGTTCAT |
| NCBI RefSeq | XM_379684 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cardiovascular disease (CVD) |