shRNA Lentivirus (self-inactivating), p7SK-(LOC392563-shRNA-Seq3)(CAT#: LV-SI3266WQ)
This product is a LOC392563-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LOC392563-shRNA-Seq3 |
| Related Target/Protein | LOC392563 |
| Region | CDS |
| TargetSeq | CCGGATAATTACGATCCGATA |
| NCBI RefSeq | XM_373382 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurodegenerative diseases |