shRNA Lentivirus (self-inactivating), p7SK-(LOC80154-shRNA-Seq3)(CAT#: LV-SI1254WQ)
This product is a LOC80154-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LOC80154-shRNA-Seq3 |
Related Target/Protein | LOC80154 |
Region | 3UTR |
TargetSeq | GCATGGCCTATGAAGTGTGTT |
NCBI RefSeq | NM_025084 |
Titer | >1*10^10 GC/mL |
Related Diseases | Laryngeal cancer |