shRNA Lentivirus (self-inactivating), p7SK-(LSM12-shRNA-Seq1)(CAT#: LV-SI1475WQ)

This product is a LSM12-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LSM12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LSM12-shRNA-Seq1
Related Target/Protein LSM12
Region 3UTR
TargetSeq CCTTTACTTCTGACTTTCCTT
NCBI RefSeq NM_152344
Alternative Names PNAS-135
Titer >1*10^10 GC/mL
Related Diseases Oxidative Stress
Target Gene
Gene ID 124801
Uniprot ID Q3MHD2

Related Products