shRNA Lentivirus (self-inactivating), p7SK-(Lypd1-shRNA-Seq1)(CAT#: LV-SI3976WQ)
This product is a Lypd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Lypd1 gene may play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. The expression of Lypd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Lypd1-shRNA-Seq1 |
| Related Target/Protein | Lypd1 |
| Region | CDS |
| TargetSeq | CAGAAAGAAGTGATGGAGCAA |
| NCBI RefSeq | NM_145100 |
| Alternative Names | PHTS; LYPDC1 |
| Titer | >1*10^10 GC/mL |
