shRNA Lentivirus (self-inactivating), p7SK-(Med18-shRNA-Seq2)(CAT#: LV-SI3579WQ)
This product is a Med18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Med18-shRNA-Seq2 |
| Related Target/Protein | Med18 |
| Region | CDS |
| TargetSeq | CCCTCTCCTATCTTGTGGAAT |
| NCBI RefSeq | NM_026039 |
| Alternative Names | SRB5; p28b |
| Titer | >1*10^10 GC/mL |