shRNA Lentivirus (self-inactivating), p7SK-(Mto1-shRNA-Seq1)(CAT#: LV-SI4024WQ)
This product is a Mto1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Mto1 gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The expression of Mto1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Mto1-shRNA-Seq1 |
| Related Target/Protein | Mto1 |
| Region | CDS |
| TargetSeq | CAAAGTGCTAAACCGGCGTAA |
| NCBI RefSeq | NM_026658 |
| Alternative Names | CGI-02; COXPD10 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Deafness |