shRNA Lentivirus (self-inactivating), p7SK-(MUM1L1-shRNA-Seq1)(CAT#: LV-SI1456WQ)

This product is a MUM1L1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert MUM1L1-shRNA-Seq1
Related Target/Protein MUM1L1
Region CDS
TargetSeq CACATCCGTTTGAAACAGGAA
NCBI RefSeq NM_152423
Alternative Names MUM1L1
Titer >1*10^10 GC/mL
Related Diseases Endometrial carcinoma
Target Gene
Gene ID 139221
Uniprot ID Q5H9M0

Related Products