shRNA Lentivirus (self-inactivating), p7SK-(Mvp-shRNA-Seq1)(CAT#: LV-SI4030WQ)
This product is a Mvp-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Mvp gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The expression of Mvp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Mvp-shRNA-Seq1 |
| Related Target/Protein | Mvp |
| Region | CDS |
| TargetSeq | GTGGAAGTCGTGGAGATCATT |
| NCBI RefSeq | NM_080638 |
| Alternative Names | LRP; VAULT1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |