shRNA Lentivirus (self-inactivating), p7SK-(N4bp2-shRNA-Seq1)(CAT#: LV-SI3623WQ)
This product is a N4bp2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | N4bp2-shRNA-Seq1 |
Related Target/Protein | N4bp2 |
Region | CDS |
TargetSeq | CTGATGACTACTTCTATATAA |
NCBI RefSeq | NM_001024917 |
Alternative Names | B3BP |
Titer | >1*10^10 GC/mL |
Related Diseases | B-cell leukemia/lymphoma |