shRNA Lentivirus (self-inactivating), p7SK-(NCRNA00207-shRNA-Seq2)(CAT#: LV-SI1332WQ)

This product is a NCRNA00207-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of NCRNA00207-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert NCRNA00207-shRNA-Seq2
Related Target/Protein NCRNA00207
Region CDS
TargetSeq CAGAATCAGATGAAGACTCCT
NCBI RefSeq NM_001012986
Alternative Names LINC00207
Titer >1*10^10 GC/mL
Target Gene
Gene ID 388910

Related Products