shRNA Lentivirus (self-inactivating), p7SK-(Obfc1-shRNA-Seq1)(CAT#: LV-SI4050WQ)

This product is a Obfc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Obfc1 gene appears to function in a telomere-associated complex with C17ORF68 and TEN1. The expression of Obfc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Obfc1-shRNA-Seq1
Related Target/Protein Obfc1
Region CDS
TargetSeq GCAGCAGAAGATCTACCACAT
NCBI RefSeq NM_175360
Alternative Names AAF44; OBFC1; AAF-44; RPA-32; bA541N10.2; STN1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79991
Uniprot ID Q9H668

Related Products