shRNA Lentivirus (self-inactivating), p7SK-(Olfr1532-ps1-shRNA-Seq4)(CAT#: LV-SI3735WQ)
This product is a Olfr1532-ps1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr1532-ps1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1532-ps1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Olfr1532-ps1-shRNA-Seq4 |
| Related Target/Protein | Olfr1532-ps1 |
| Region | CDS |
| TargetSeq | CTCTTCTATGGCTCAGGAATA |
| NCBI RefSeq | NM_001011542 |
| Alternative Names | Olfr708; MOR260-6P; MOR260-9P; GA_x6K02T2PBJ9-9297671-9298594 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |
| Target Gene | |
|---|---|
| Gene ID | 258173 |
| Uniprot ID | A0A0R4J8U2 |