shRNA Lentivirus (self-inactivating), p7SK-(Olfr410-shRNA-Seq1)(CAT#: LV-SI4009WQ)

This product is a Olfr410-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr410 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr410-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr410-shRNA-Seq1
Related Target/Protein Olfr410
Region CDS
TargetSeq CTTAGTCCATAAGCGTACAAT
NCBI RefSeq NM_146707
Alternative Names MOR255-5
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258702
Uniprot ID Q8VFX7

Related Products