shRNA Lentivirus (self-inactivating), p7SK-(Olfr912-shRNA-Seq1)(CAT#: LV-SI3963WQ)
This product is a Olfr912-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr912 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr912-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Olfr912-shRNA-Seq1 |
| Related Target/Protein | Olfr912 |
| Region | CDS |
| TargetSeq | CTAAAGTCTGTTCCTATCTTA |
| NCBI RefSeq | NM_146810 |
| Alternative Names | MOR165-4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |
| Target Gene | |
|---|---|
| Gene ID | 258806 |
| Uniprot ID | A0A1L1SSS5 |
