shRNA Lentivirus (self-inactivating), p7SK-(OR1J4-shRNA-Seq2)(CAT#: LV-SI3330WQ)

This product is a OR1J4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR1J4 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR1J4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR1J4-shRNA-Seq2
Related Target/Protein OR1J4
Region CDS
TargetSeq GCATGCAAACTCAGGATCAAT
NCBI RefSeq XM_294533
Alternative Names OR9-21; HTPCRX01; HSHTPCRX01
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 26219
Uniprot ID Q8NGS1

Related Products