shRNA Lentivirus (self-inactivating), p7SK-(OR52E5-shRNA-Seq1)(CAT#: LV-SI3298WQ)
This product is a OR52E5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR52E5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR52E5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | OR52E5-shRNA-Seq1 |
| Related Target/Protein | OR52E5 |
| Region | CDS |
| TargetSeq | CCTTCTAGGGAACATCATTAT |
| NCBI RefSeq | XM_372369 |
| Alternative Names | OR11-56 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |