shRNA Lentivirus (self-inactivating), p7SK-(PIGY-shRNA-Seq1)(CAT#: LV-SI1069WQ)
This product is a PIGY-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PIGY gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. The expression of PIGY-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PIGY-shRNA-Seq1 |
| Related Target/Protein | PIGY |
| Region | CDS |
| TargetSeq | GAAGCAAGAAGAAGTGGAGCA |
| NCBI RefSeq | NM_032906 |
| Alternative Names | PREY |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hyperphosphatasia and mental retardation syndrome |