shRNA Lentivirus (self-inactivating), p7SK-(PLEKHA6-shRNA-Seq1)(CAT#: LV-SI1389WQ)
This product is a PLEKHA6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PLEKHA6 gene is associated with psychopathology and response to treatment in schizophrenic patients.The expression of PLEKHA6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | PLEKHA6-shRNA-Seq1 |
Related Target/Protein | PLEKHA6 |
Region | CDS |
TargetSeq | CCAGCATTATGACGTGGACAT |
NCBI RefSeq | NM_014935 |
Alternative Names | PEPP3; PEPP-3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Schizophrenic |