shRNA Lentivirus (self-inactivating), p7SK-(PLEKHM1-shRNA-Seq1)(CAT#: LV-SI1432WQ)

This product is a PLEKHM1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PLEKHM1 gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. The expression of PLEKHM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PLEKHM1-shRNA-Seq1
Related Target/Protein PLEKHM1
Region 3UTR
TargetSeq GCCAGTGCTTTCAGATGCATT
NCBI RefSeq NM_014798
Alternative Names B2; AP162; OPTA3; OPTB6
Titer >1*10^10 GC/mL
Related Diseases Autosomal recessive osteopetrosis type 6 (OPTB6)
Target Gene
Gene ID 9842
Uniprot ID Q9Y4G2

Related Products