shRNA Lentivirus (self-inactivating), p7SK-(PRR14-shRNA-Seq1)(CAT#: LV-SI1434WQ)
This product is a PRR14-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PRR14 gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The expression of PRR14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PRR14-shRNA-Seq1 |
| Related Target/Protein | PRR14 |
| Region | CDS |
| TargetSeq | CGATTCAGAATACGCAGAACA |
| NCBI RefSeq | NM_024031 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer |