shRNA Lentivirus (self-inactivating), p7SK-(Pus7-shRNA-Seq2)(CAT#: LV-SI3484WQ)

This product is a Pus7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pus7 gene encodes pseudouridylate synthase that catalyzes pseudouridylation of RNAs. The expression of Pus7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Pus7-shRNA-Seq2
Related Target/Protein Pus7
Region CDS
TargetSeq GACTTTGTCGTTCACGAAATC
NCBI RefSeq NM_178403
Alternative Names IDDABS
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54517
Uniprot ID Q96PZ0

Related Products