shRNA Lentivirus (self-inactivating), p7SK-(Scap-shRNA-Seq1)(CAT#: LV-SI3981WQ)
This product is a Scap-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Scap gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The expression of Scap-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Scap-shRNA-Seq1 |
Related Target/Protein | Scap |
Region | CDS |
TargetSeq | CATCCTGTTTGCCTACATCTA |
NCBI RefSeq | NM_001001144 |
Titer | >1*10^10 GC/mL |