shRNA Lentivirus (self-inactivating), p7SK-(SF3A2-shRNA-Seq1)(CAT#: LV-SI1061WQ)
This product is a SF3A2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SF3A2 gene encodes subunit 2 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SF3A2-shRNA-Seq1 |
| Related Target/Protein | SF3A2 |
| Region | CDS |
| TargetSeq | CTGGGCTCCTATGAATGCAAA |
| NCBI RefSeq | NM_007165 |
| Alternative Names | PRP11; SAP62; PRPF11; SF3a66 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mitotic chromosome segregation |