shRNA Lentivirus (self-inactivating), p7SK-(SF3A3-shRNA-Seq4)(CAT#: LV-SI1059WQ)
This product is a SF3A3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SF3A3 gene encodes subunit 3 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SF3A3-shRNA-Seq4 |
| Related Target/Protein | SF3A3 |
| Region | CDS |
| TargetSeq | CTGAGGGATTTGTATGATGAT |
| NCBI RefSeq | NM_006802 |
| Alternative Names | PRP9; PRPF9; SAP61; SF3a60 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer |