shRNA Lentivirus (self-inactivating), p7SK-(SGMS2-shRNA-Seq1)(CAT#: LV-SI3797WQ)
This product is a SGMS2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SGMS2 gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The expression of SGMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SGMS2-shRNA-Seq1 |
| Related Target/Protein | SGMS2 |
| Region | 3UTR |
| TargetSeq | GCTGTAACCAAAGGTATAGTT |
| NCBI RefSeq | NM_152621 |
| Alternative Names | CDL; SMS2 |
| Titer | >1*10^10 GC/mL |
