shRNA Lentivirus (self-inactivating), p7SK-(SPAG17-shRNA-Seq3)(CAT#: LV-SI1225WQ)
This product is a SPAG17-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPAG17 gene encoded protein is required for the proper function of the axoneme. SPAG17 deficiency results in skeletal malformations and bone abnormalities. The expression of SPAG17-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SPAG17-shRNA-Seq3 |
Related Target/Protein | SPAG17 |
Region | CDS |
TargetSeq | GCACAGTATGAAGAACCGCAA |
NCBI RefSeq | NM_206996 |
Alternative Names | PF6; CT143 |
Titer | >1*10^10 GC/mL |
Related Diseases | Skeletal malformations and bone abnormalities |