shRNA Lentivirus (self-inactivating), p7SK-(Sval3-shRNA-Seq1)(CAT#: LV-SI3594WQ)
This product is a Sval3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Sval3 gene has the aspartic-type endopeptidase activity. The expression of Sval3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Sval3-shRNA-Seq1 |
| Related Target/Protein | Sval3 |
| Region | CDS |
| TargetSeq | CAATAGAAACAAGTCACTTTC |
| NCBI RefSeq | NM_001003952 |
| Titer | >1*10^10 GC/mL |