shRNA Lentivirus (self-inactivating), p7SK-(Tatdn1-shRNA-Seq1)(CAT#: LV-SI3923WQ)
This product is a Tatdn1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tatdn1 gene is putative deoxyribonuclease. The expression of Tatdn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tatdn1-shRNA-Seq1 |
Related Target/Protein | Tatdn1 |
Region | CDS |
TargetSeq | CAACCTGACAGATCCTATGTT |
NCBI RefSeq | NM_175151 |
Alternative Names | CDA11 |
Titer | >1*10^10 GC/mL |