shRNA Lentivirus (self-inactivating), p7SK-(TCTN3-shRNA-Seq1)(CAT#: LV-SI3943WQ)
This product is a TCTN3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TCTN3 gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. The expression of TCTN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TCTN3-shRNA-Seq1 |
| Related Target/Protein | TCTN3 |
| Region | CDS |
| TargetSeq | CATACCAGTTTCCCTGGAGAT |
| NCBI RefSeq | NM_015631 |
| Alternative Names | OFD4; TECT3; JBTS18; C10orf61 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Orofaciodigital Syndrome IV and Joubert Syndrom 18 |