shRNA Lentivirus (self-inactivating), p7SK-(TMEM167B-shRNA-Seq2)(CAT#: LV-SI3205WQ)

This product is a TMEM167B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by TMEM167B nvolved in the early part of the secretory pathway. The expression of TMEM167B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TMEM167B-shRNA-Seq2
Related Target/Protein TMEM167B
Region CDS
TargetSeq GCTTGTGTTGTAATGGCCTTT
NCBI RefSeq NM_020141
Alternative Names AD-020; C1orf119
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 56900
Uniprot ID Q9NRX6

Related Products