shRNA Lentivirus (self-inactivating), p7SK-(Tmem26-shRNA-Seq1)(CAT#: LV-SI3912WQ)
This product is a Tmem26-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tmem26 gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. The expression of Tmem26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Tmem26-shRNA-Seq1 |
| Related Target/Protein | Tmem26 |
| Region | CDS |
| TargetSeq | CAGAGGCTTTGTCGACAATTT |
| NCBI RefSeq | NM_177794 |
| Titer | >1*10^10 GC/mL |
