shRNA Lentivirus (self-inactivating), p7SK-(TXNDC5-shRNA-Seq1)(CAT#: LV-SI3316WQ)
This product is a TXNDC5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TXNDC5 gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The expression of TXNDC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TXNDC5-shRNA-Seq1 |
| Related Target/Protein | TXNDC5 |
| Region | CDS |
| TargetSeq | CGAAACTGTCAAGATTGGCAA |
| NCBI RefSeq | NM_022085 |
| Alternative Names | HCC2; ERP46; HCC-2; STRF8; PDIA15; UNQ364; ENDOPDI |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Disulfide-isomerase deficiency |