shRNA Lentivirus (self-inactivating), p7SK-(Vmn1r9-shRNA-Seq5)(CAT#: LV-SI3766WQ)
This product is a Vmn1r9-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Vmn1r9 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Vmn1r9-shRNA-Seq5 |
| Related Target/Protein | Vmn1r9 |
| Region | CDS |
| TargetSeq | GCTTACAGACTTATTTGAGTT |
| NCBI RefSeq | NM_134185 |
| Alternative Names | V1rc30 |
| Titer | >1*10^10 GC/mL |