shRNA Lentivirus (self-inactivating), p7SK-(Vps13a-shRNA-Seq1)(CAT#: LV-SI3915WQ)
This product is a Vps13a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Vps13a gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. The expression of Vps13a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Vps13a-shRNA-Seq1 |
| Related Target/Protein | Vps13a |
| Region | CDS |
| TargetSeq | CCGTTTACAGATGTCAGTATT |
| NCBI RefSeq | NM_173028 |
| Alternative Names | CHAC; CHOREIN |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal recessive disorder, chorea-acanthocytosis |