shRNA Lentivirus (self-inactivating), p7SK-(WDR74-shRNA-Seq3)(CAT#: LV-SI1455WQ)
This product is a WDR74-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR74 gene participates in an early cleavage of the pre-rRNA processing pathway in cooperation with NVL and is required for blastocyst formation, is necessary for RNA transcription, processing and/or stability during preimplantation development. The expression of WDR74-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | WDR74-shRNA-Seq3 |
| Related Target/Protein | WDR74 |
| Region | CDS |
| TargetSeq | GTGGGAAAGAGAATGCTTTGA |
| NCBI RefSeq | NM_018093 |
| Alternative Names | Nsa1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mammary adenocarcinoma |