shRNA Lentivirus (self-inactivating), p7SK-(ZDHHC3-shRNA-Seq3)(CAT#: LV-SI1471WQ)
This product is a ZDHHC3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZDHHC3 Tyrosine Phosphorylation Regulates Neural Cell Adhesion Molecule Palmitoylation. The expression of ZDHHC3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | ZDHHC3-shRNA-Seq3 |
| Related Target/Protein | ZDHHC3 |
| Region | CDS |
| TargetSeq | GTGGATGAACATGAAAGCCGT |
| NCBI RefSeq | NM_016598 |
| Alternative Names | GODZ; DHHC3; DHHC-3; ZNF373 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast Cancer |