shRNA Lentivirus (self-inactivating), p7SK-(Zpbp-shRNA-Seq4)(CAT#: LV-SI3659WQ)
This product is a Zpbp-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida. The expression of Zpbp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Zpbp-shRNA-Seq4 |
Related Target/Protein | Zpbp |
Region | CDS |
TargetSeq | CCTGTGAAATATCCTTGATTA |
NCBI RefSeq | NM_015785 |
Alternative Names | ZPBP1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |