shRNA Lentivirus (self-inactivating), p7SK-(Zpbp-shRNA-Seq4)(CAT#: LV-SI3659WQ)
This product is a Zpbp-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida. The expression of Zpbp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Zpbp-shRNA-Seq4 |
| Related Target/Protein | Zpbp |
| Region | CDS |
| TargetSeq | CCTGTGAAATATCCTTGATTA |
| NCBI RefSeq | NM_015785 |
| Alternative Names | ZPBP1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |