shRNA Lentivirus (self-inactivating), pH1-(ANKS6-shRNA-Seq4)(CAT#: LV-SI2753WQ)

This product is a ANKS6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by ANKS6 gene may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. The expression of ANKS6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ANKS6-shRNA-Seq4
Related Target/Protein ANKS6
Region CDS
TargetSeq CTCCATCTGGAACTTCCACTA
NCBI RefSeq NM_173551
Alternative Names PKDR1; SAMD6; NPHP16; ANKRD14
Titer >1*10^10 GC/mL
Related Diseases Nephronophthisis
Target Gene
Gene ID 203286
Uniprot ID Q68DC2

Related Products