shRNA Lentivirus (self-inactivating), pH1-(AY358078-shRNA-Seq2)(CAT#: LV-SI2650WQ)

This product is a AY358078-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of AY358078-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert AY358078-shRNA-Seq2
Related Target/Protein AY358078
Region CDS
TargetSeq GTAACAGTCCACCAACTTATC
NCBI RefSeq NM_194347
Titer >1*10^10 GC/mL
Target Gene
Gene ID 278676
Uniprot ID Q6UY53

Related Products