shRNA Lentivirus (self-inactivating), pH1-(BBS5-shRNA-Seq2)(CAT#: LV-SI2362WQ)
This product is a BBS5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BBS5 gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. The expression of BBS5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | BBS5-shRNA-Seq2 |
Related Target/Protein | BBS5 |
Region | CDS |
TargetSeq | GTGGATATGTTCTTGGCTTTA |
NCBI RefSeq | NM_152384 |
Titer | >1*10^10 GC/mL |
Related Diseases | Bardet-Biedl syndrome |