shRNA Lentivirus (self-inactivating), pH1-(BC003266-shRNA-Seq1)(CAT#: LV-SI3148WQ)

This product is a Smim12-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Smim12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert BC003266-shRNA-Seq1
Related Target/Protein BC003266
Region 3UTR
TargetSeq CCTGTGTGCATTCTTCCCTTT
NCBI RefSeq NM_030252
Alternative Names Smim12
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80284
Uniprot ID Q78RX3

Related Products