shRNA Lentivirus (self-inactivating), pH1-(C10orf27-shRNA-Seq1)(CAT#: LV-SI0980WQ)
This product is a C10orf27-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C10orf27-shRNA-Seq1 |
Related Target/Protein | C10orf27 |
Region | CDS |
TargetSeq | GAGTACATTGGAGAAGCTCAA |
NCBI RefSeq | NM_152710 |
Alternative Names | SPATIAL; TBATA |
Titer | >1*10^10 GC/mL |
Related Diseases | Multiple sclerosis (MS) |