shRNA Lentivirus (self-inactivating), pH1-(C10orf82-shRNA-Seq3)(CAT#: LV-SI0802WQ)

This product is a C10orf82-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C10orf82-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C10orf82-shRNA-Seq3
Related Target/Protein C10orf82
Region CDS
TargetSeq GCAAATATGTAAAGAAACCTC
NCBI RefSeq NM_144661
Titer >1*10^10 GC/mL
Target Gene
Gene ID 143379
Uniprot ID Q8WW14

Related Products